Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST89-1
Clone ID PST89-1
Vector U3NeoSV1
Project escells

Sequence tag PST89-1
Sequence
GGCCGGTGCCCAGGTGTGTGGGCATGAGGACTACNTGACACCTGACNTGCCCTTGAGCTAAGTGAAGCCAGATTGCTTCC
CAGACAGTGGGAGGGAGGAGGAGCCTGCCAGCCCTGGTGGAGGAAGGGTCTGGGCCCTCTGCTGCTGGAGGTCCTGTCTC
TGACCTGTTTCTGCTTCTCCCGCAGCAAGGTTGAAGCATGGAGCTGCGTGTGGGAAATAAGTATCGCCTGGGCCGAAAGA
TCGGCAGTGGCTCCTTTGGAGACATCTACCTGGGTAAGTAGCTAGGCCTCCAGCTATGGCCCTTTGGGGCGGCTCTGGGA
TGAGGAGGAGGGGAGAACCTGGGATCTGGGAGCAGGAGTTTGCTCTGGTTGCCTGGCATGGCTTACAAGCCTCCAGGGTC
ATCCCGGATCCAGAAGAAGCTCAGG
Sequence Type genomic DNA
Unitrap ID UNI14402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79269049..79269472 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022433 (Csnk1e) NM_013767 casein kinase 1, epsilon Gene [Source:MGI (curated);Acc:Csnk1e-001]

 
Come back to gene ENSMUSG00000022433


For any suggestions or comments, please send an email to unitrap@crg.es