Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13677C4
Clone ID IST13677C4
Vector VICTR74
Project tigm

Sequence tag IST13677C4BBF1
Sequence
TGGAGGGGCGGCATCACTTAGGTGCGGCGTGTGTTTGGTGATGGATAGCCNGGTTTTTTTGTTTTGTTTTGTTTGAGTGT
CTTGTTTCTGATAGGAGCTAATCTCTCATCGTAACCAGGAATAAGGTGGGAATTGGCGCCTGCATTGCTGTAGGGAGACT
TACAGCAAGCCCTTGCTGGGCTTTGANAACCTTTCTCCCTGTGAGATGCCTAANCGGGTGGTCAANAATCTCANTTCTTA
CCCTGTGGCANANAAAAAGGAACGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165636725..165636993 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es