Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12478C5
Clone ID IST12478C5
Vector VICTR76
Project tigm

Sequence tag IST12478C5HMF1
Sequence
AACCCGAGGGGCTGTTGTGGGGAGGCTGAGCCGCGCCACGCTGTTGGCACGTTGTCAAGAACCACGCTCANCGCCTTGTT
TGTACGCCTCCAAGTTTCATTGTCTTCCTGACACCCCATGCTCGGCCCAGGCGCCGCGTGGTTTCTAGTGCCGTTTCTGG
GGCAGGGCTTTGCGGTTGATGTTCNANGANACCCTGA
Sequence Type genomic DNA
Unitrap ID UNI10902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71199829..71200024 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]


Sequence tag IST12478C5BBF1
Sequence
AACCCGAGGGGCTGTTGTGGGGAGGCTGAGCCGCGCCACGCTGTTGGCACGTTGTCAAGAACCACGCTCAGCGCCTTGTT
TGTACGCCTCCAAGTTTCATTGTCTTCCTGACACCCCATGCTCGGCCCAGGCGCCGCGTGGTTTCTAGTGCCGTTTCTGG
GGCAGGGCTTTGCGGTTGATGTTCTAGGAGACCCTGGCACCTCGCTTTTCCCTGTGGGGGGTCCTTGGCGAATTCCAGTC
GCCTTACCTTTTGTCTAAAAGTTTGTAGTTCCGGGTGTTCTCTCACTCCTCNCCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI10902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71199726..71200024 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]

 
Come back to gene ENSMUSG00000047407


For any suggestions or comments, please send an email to unitrap@crg.es