Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13382F11
Clone ID IST13382F11
Vector VICTR74
Project tigm

Sequence tag IST13382F11BBF1
Sequence
TAATNNATTTTTTTAAGGAGCAGTTGTAACTAGAAGGCTTGTAAAGTTATTAANAGTTACATGTGCATAATTTATTTATT
AACTAGAAATATGCATAAGCAATTGTAAATTTGAGAATTAATAGTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCT
CANANATATGGCATTGACTATTAATATACAAATTAAGGTTTGATTGTTCNNCATTTTAAAACACCATCTACAGCACACAA
CNANATNATCTGTGCTGGAACAGGGGAAACTGTGTCTTAAGACTCCGCCCCNCANAAGCTANTTGGGCCCACGTGNNCNA
ACNATCNGCTGGGANGATGANAAANNTGACTTTACNANNNTGTNNNCNTTTNGGNNNNNNAATTNTTTTGGGCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13382F11HMF1
Sequence
NANNNNATTTTTTTAAGGAGCAGTTGTAACTANAAGGCTTGTAAAGTTATTAAGAGTTACATGTGCATAATTTATTTATT
AACTANAAATATGCATAAGCAATTGTAAATTTGAGAATTAATAGTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCT
CANAGATATGGCATTGACTATTAATATACAAATTAAGGTTTGATTGTTCANCATTTTAAAACACCATCTACAGCACACAA
CTANATCATCTGTGCTGGAACAGGGGAAACTGTGTCTTAANACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCA
ACNATCGGCTGGGAGGATGANAAAAATGACTTTACAATAATGTTTTCTTTTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469075..7469443 353
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920052..52920420 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776706..115777074 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  

 
Come back to gene ENSMUSG00000030321


For any suggestions or comments, please send an email to unitrap@crg.es