Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST746
Clone ID PST746
Vector U3NeoSV1
Project escells

Sequence tag PST746
Sequence
CTTAAATCCCACTAAGGTGATGTAAAGATTCATCATCACAGAGGCAAAGAGGGGAGGGAGGGGCATCCTCAGGGTGACAG
AGGCAGCAAAGAAAAGGGCCCTGAGTGGAGTCG
Sequence Type genomic DNA
Unitrap ID UNI5398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142932162..142932273 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es