Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST72-2
Clone ID PST72-2
Vector U3NeoSV1
Project escells

Sequence tag PST72-2
Sequence
AAGTGAGGTGTGTCTGAGTGCCAGGGTGCTCCCAGAGGGAGGCCAGATCCTCCCTGCAGTCATCAGCCAGACTCCCTCCC
TCCCATGTATGCATTGAGGCCTAAATTGCAAACAGGGTTTGGAACAGAGTACCAGGGCTTTGGTTGGCTCTAAGAACATT
CTTTATAGGTGGCCATGAACTAAGGATTCTTTGTTTAAGAATCAGGCCCAGGAAACCAAATAAGGATTAACCAGGTTGTG
AGCTACACCAGCCAAAGATGAAGGGTCGCTGTGTGTTCACCGNACAGGAAAGGATGGGGACTGGACT
Sequence Type genomic DNA
Unitrap ID UNI15649

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118892082..118892389 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047409 (Ctdspl) NM_133710 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like Gene [Source:MGI Symbol;Acc:MGI:1916524]

 
Come back to gene ENSMUSG00000047409


For any suggestions or comments, please send an email to unitrap@crg.es