Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13955F9
Clone ID IST13955F9
Vector VICTR74
Project tigm

Sequence tag IST13955F9BBF1
Sequence
ATGGTGGCTTACAACCATCCGTAATGAGATCTGTCGA
Sequence Type genomic DNA
Unitrap ID UNI34505 UNI34506 UNI34507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45252629..45252664 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74932347..74932382 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60147218..60147253 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22071642..22071677 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6063714..6063749 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34735437..34735472 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 139956503..139956538 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030230 (Plcz1) NM_054066 phospholipase C, zeta 1 Gene [Source:MGI (curated);Acc:Plcz1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35755096..35755131 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063931 (Pepd) NM_008820 peptidase D Gene [Source:MGI Symbol;Acc:MGI:97542]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116467735..116467770 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028688 (Toe1) NM_026654 target of EGR1, member 1 (nuclear) Gene [Source:MGI (curated);Acc:Toe1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19120986..19121021 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 16513295..16513330 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28367286..28367321 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 180090120..180090155 34
NO GENE  


Sequence tag IST13955F9HMF2
Sequence
ATGGTGGCTTACAACCATCCGTAATGAGATCTGACTCCCTCTTCTGGAGTATCTGAGGATAGCTACAGTGTACTTACATG
TAATAAATAAATAAATCAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56870333..56870451 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es