Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10887D7
Clone ID IST10887D7
Vector VICTR76
Project tigm

Sequence tag IST10887D7HMR1
Sequence
CNCTTGTGTCGTATGTTTTTTCTTGTTTTGAGTGTGGCACTCCTCCCACCTCAGCCTCTCACGTGTTGATATTACAGCCC
TGACTCACCAATCACGGTGACAGGGATCCTGTTTCCTAACGCTTTAACGTTCTTTTTACTTTGTGAAAATAGCCTCGGGA
ACTGTGTTACGCAGTGTGTGTTGAGAAAAGATCAGGCAACAGGTTTATTGACGGATTGTTTCTCGATTTGAGGCNNGATC
TCACTAAATTACTCAGGCCGGCCNTGANNTAANGATCTGANTGCCNCACTANCTGGNATTACAGACCTGTACCN
Sequence Type genomic DNA
Unitrap ID UNI33912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55975150..55975460 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022601 (Rpl24) NM_024218 ribosomal protein L24 Gene [Source:MGI (curated);Acc:Rpl24-005]

 
Come back to gene ENSMUSG00000022601


For any suggestions or comments, please send an email to unitrap@crg.es