Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11076H8
Clone ID IST11076H8
Vector VICTR76
Project tigm

Sequence tag IST11076H8HMF1
Sequence
TTTGGGGGCACCGCTGGACCCTGACTCCTGGTCGGCAGCCACCTGGA

Sequence Type genomic DNA
Unitrap ID UNI32399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97700736..97700774 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]


Sequence tag IST11076H8BBF1
Sequence
TTTGGGGGCACCGCTGGACCCTGACTCCTGGTCGGCAGCCACCTGGCCAGAGGCTTTGTGGAGAGGGGCATTTCCTACCT
GGGTTTCACGTGAAAGCATTCTCTGGACTCCCTCCGGAACAGCAGGGAGAGGCAAGGGCTAAGTGTAATCTGAGTGAGCT
GAGTGTGGGGAGTGCTCCAGGCAGGGGAAGGACCTAGCAGCGTTCGAGTTTCCCAAGAGCAGCCCAAAAGCCTGTGACCC
AGTGTGGCCTTGTCTGCTGGACTCGCCTGCTCAGGAGGGCTCCCCTCTTGNNNGTGGACTAAGTTCCTGTTANAAAGGGT
GTTACTGGCCGGGCGCAGTGGTGCACGACTTTAATCCCAGCACTCGGGANGCAGANGCAGGTGGATTTCTGAGTTTGANG
CCNGCCTGGTCTACAAAGTGAGTTCCNGGNCTGCNGGNAAACCCTGTCTCNNAAAACCNANNAAAAAAAAAAAAAAAAAA
N

Sequence Type genomic DNA
Unitrap ID UNI32399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97700736..97701208 439
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es