Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12629C8
Clone ID IST12629C8
Vector VICTR76
Project tigm

Sequence tag IST12629C8BBF1
Sequence
CCAGGAAGAACGCAACAAACCGGAATCTTCTGCGGCAAAGCTTTATTGCTTACATCTTCAGGAGCCAGAGAGCAAGAGAG
CAAGAGCAAGAGCTCTATTGCTTACATCTTTAGGAGCCANAACGCAAGAGCGCAAGAGTGCAAGAGCGGGCTGGTGAGAT
GGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCTGAANTTCAAATCCCAGCAACNACATGGTGGCTCACAAC
CNTCTGTNACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI34903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115682094..115682351 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059900 (Tmem40) NM_144805 transmembrane protein 40 Gene [Source:MGI (curated);Acc:Tmem40-001]


Sequence tag IST12629C8HMF1
Sequence
CCNNGAANAACGCANCAAACCGGAATCTTCTGCGGCAAAGCTTTATTGCTTACATCTTN
Sequence Type genomic DNA
Unitrap ID UNI30820 UNI35398 UNI35399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 5545458..5545511 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29737487..29737540 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8838257..8838310 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14447458..14447511 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12955839..12955892 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32090529..32090582 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019027 (Dnahc1) dynein, axonemal, heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:107721]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4785409..4785462 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 47280125..47280178 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 16896682..16896735 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6912399..6912452 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 39990750..39990803 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6387119..6387172 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 26975551..26975604 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 7061083..7061136 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6889393..6889446 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7410640..7410693 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 46414002..46414055 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 22156851..22156904 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 9599066..9599119 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 142479..142532 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079193 (AC133103.5-208)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 23863392..23863445 50
NO GENE  

 
Come back to gene ENSMUSG00000079193


For any suggestions or comments, please send an email to unitrap@crg.es