Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14302G9
Clone ID IST14302G9
Vector VICTR74
Project tigm

Sequence tag IST14302G9HMR1
Sequence
CCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCA
GGACTACACAGAGAAACCCTGTCTCAAAAACANNAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI9030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 51379737..51379862 122
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40785626..40785751 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es