Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6177-NL
Clone ID PST6177-NL
Vector U3NeoSV1
Project escells

Sequence tag PST6177-NL
Sequence
CATGTAGTAACCCATGGCTCTTGCCCCGCGGTCTCCTCCCAACCACGTGCAGGAGAGTATGGACTCCGGAACAAACGTGA
GGTTTGGAGGGTCAAGTTTACCCTGGCCAAGATCCGTAAGGCGGCCCGGGAGCTGTTGACGCTGGACGAGAAGGATCCCC
GGGCGTCTGTTTGAAGGTGTGTATGAGCCTATTTTCGAAGGAGTGGTGGTTGCTGAGTGTTTTAGGGCGTGGGAGATGTG
ACTGAACAAGTTGGGTC
Sequence Type genomic DNA
Unitrap ID UNI15659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3656196..3656449 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006333 (Rps9) NM_029767 ribosomal protein S9 Gene [Source:MGI (curated);Acc:Rps9-001]

 
Come back to gene ENSMUSG00000006333


For any suggestions or comments, please send an email to unitrap@crg.es