Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11773E2
Clone ID IST11773E2
Vector VICTR76
Project tigm

Sequence tag IST11773E2BBF1
Sequence
CAGTCGGGTGCTCTTACCTGCTGAGCCATCTCTCCAGCCCCCTGTTTTTTATTTTTAAAACAATTATTATTAATTTCTCT
CTGTGTCTCTGTCTCTCTGTGTATGTGTGTGTGGAAGTGCAAGTGCCCAGAGAAGGACAGAATTTAAAATTACATGTGTT
GGTGTACAGGTGTTGGTGCGCACACACGAAGGTTAGAGACTAAGAAACAGGAGCTGATTTCTGTTAATCACCGACCCAGA
TCATCTTGGCCTGATGAATGAAAACAAGCAACTCAAGACTGGCCTGGTCTACAGAATGAGTTCCAGGACAGCCAGGGCTA
CACAGANGGACTCTTGTCTTGAAAAACCAAACCACAAGCCCGGGGTGGTGGTGCACGCTTTTAATCCCAGCACTTGGGAG
GCACAGACAGGCANATTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116810102..116810519 414
NO GENE  


Sequence tag IST11773E2HMF1
Sequence
CAGTCGGGTGCTCTTACCTGCTGAGCCATCTCT
Sequence Type genomic DNA
Unitrap ID UNI4071 UNI11806 UNI31148 UNI35402 UNI35403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61510437..61510469 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4535631..4535663 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22325495..22325527 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41492333..41492365 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13919850..13919882 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3261676..3261708 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 21072513..21072545 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4912871..4912903 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026669 (Mcm10) NM_027290 minichromosome maintenance deficient 10 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Mcm10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86106941..86106973 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028080 (Lrba) NM_030695 LPS-responsive beige-like anchor Gene [Source:MGI Symbol;Acc:MGI:1933162]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 109907630..109907662 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028546 (Elavl4) NM_010488 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene [Source:MGI (curated);Acc:Elavl4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 119387600..119387632 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3249918..3249950 33
NO GENE  

 
Come back to gene ENSMUSG00000028546


For any suggestions or comments, please send an email to unitrap@crg.es