Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14281F7
Clone ID IST14281F7
Vector VICTR74
Project tigm

Sequence tag IST14281F7BBF1
Sequence
GGGGTAGAATGCTGGTGCCCTCCGTCACTCCTGATGCCTCTTCTCCCTCTGTGGAGACACAGGCCAGTGACAGGGAACAT
CCCCATTCCCTGGAGCAAGCCCCTCCCCCTCCCCAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75110919..75111038 120
 
EST/CDNA Est Name
  AA415222.1 - BE334232.1


Sequence tag IST14281F7HMR1
Sequence
NCCAAGAACCACGCTACAGTCACCAGATAAAAATGGCTGCCACAGGTCACCTGGCTGANCAACACT
Sequence Type genomic DNA
Unitrap ID UNI27774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75110856..75110920 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]


Sequence tag IST14281F7HMF1
Sequence
GGGGTAGAATGCTGGTGCCCTCCGTCACTCCTGATGCCTCTTCTCCCTCTGTGGAGACACAGGCCAGTGACAGGGAACAT
CCCCATTCCCTGGAGCAAGCCCCTCCCCCTCCCCAGGATCCACGTTTCTGTGCCAGGCCTTGCAGGACCTGACTATGCCC
TANGACCTATGACCCTATGACGGGAATGCGGCGCTCTATCTCCNCAGGAGCCNNGGANNNNCNNANCACANGCNNGTANT
TTCNNNANNTGTNTCNCACCTTANGTAGACTGTGTCTGTGTGTGTACNGTGGNNCNNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es