Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14503C8
Clone ID IST14503C8
Vector VICTR74
Project tigm

Sequence tag IST14503C8HMF1
Sequence
CAAACACACCTAAATATAACTAAAAAGAATAAAAACATATCTTAAGAAAAGAATCTGGGATGCTAANAAGGGAACACAAA
AGTCACTTACTCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88080297..88080394 96
NO GENE  


Sequence tag IST14503C8HMR1
Sequence
ACNAGNCTGGAGCCAAGTGAGAAATCTGCCCTCTTGAGGCCTAGCACAGAGCCGGCTGAAGAGTTCCAAGACCAAGTGAA
ACCCCTCCAGGAGTAGGACCTAGGATTCCAGACTTTCTGTCAGACACCCTTGGATAAGCCTGTACCCCTGGGCTAGCCCT
TATCACTGGGGAGTTCTGAGGAAATGCCACCAGGGGAGCATGGTTAGAGGTAGCTGTGTTGGCTTTAGGGGGAGGGTAAG
GATTGAGGCTC
Sequence Type genomic DNA
Unitrap ID UNI30101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125971301..125971550 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001482 (Def8) NM_054046 differentially expressed in FDCP 8 Gene [Source:MGI (curated);Acc:Def8-003]

 
Come back to gene ENSMUSG00000001482


For any suggestions or comments, please send an email to unitrap@crg.es