Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5978-NR
Clone ID PST5978-NR
Vector U3NeoSV1
Project escells

Sequence tag PST5978-NR
Sequence
AAACAAAATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCAGTGGCTCCATCAACATCTACCTGTTTCATA
AGTCCTCCTACGCGGACAGCGTTCTCACTCACCTGAACCTTCTGCGTCAGCAGCGGCTCTTCACAGATGTCCTTCTCCAT
GCGGGAAACAGGACCTTCCCTTGCCACCGGGCAGTGCTGGCTGCGTGCAGCCGCTACTTCGAAGCCATGTTCAGTGGTGG
CCTGAAAGAGAGCCAGGA
Sequence Type genomic DNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98014932..98015189 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es