Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12807D5
Clone ID IST12807D5
Vector VICTR76
Project tigm

Sequence tag IST12807D5HMF1
Sequence
CTGGCAACTCCATTCATAGGCATATTACATGGGAGAAACTCTTGTGCCCTGAGTTCTGGGAGATACACTGTAACAATCAT
ACAGAAN
Sequence Type genomic DNA
Unitrap ID UNI32360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130996301..130996386 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027329 (Spef1) NM_027641 sperm flagellar 1 Gene [Source:MGI (curated);Acc:Spef1-001]


Sequence tag IST12807D5BBF1
Sequence
CTGGCAACTCCATTCATAGGCATATTACATGGGAGAAACTCTTGTGCCCTGAGTTCTGGGAGATACACTGTAACAATCAT
ACAGAATTGAAGTGATGGGCTGGAGAGATGGCTTANCCGTTAAGAGCATTTGCTGTTCTTACAGAGGACACAGGTTCCAT
GCCCAGCACCCACATGACAGCTCACAAC
Sequence Type genomic DNA
Unitrap ID UNI32360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130996199..130996386 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027329 (Spef1) NM_027641 sperm flagellar 1 Gene [Source:MGI (curated);Acc:Spef1-001]

 
Come back to gene ENSMUSG00000027329


For any suggestions or comments, please send an email to unitrap@crg.es