Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15084G6
Clone ID IST15084G6
Vector VICTR80
Project tigm

Sequence tag IST15084G6HMF1
Sequence
TTTGGCCCTGGCGTTCCCCTGTACTGAGGCATATAAAGTTTGCAAGACCAAGGGGCCTCTCTTTCCAATGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36271246..36271319 74
NO GENE  


Sequence tag IST15084G6BBF1
Sequence
TTTGGCCCTGGCGTTCCCCTGTACTGAGGCATATAAAGTTTGCAAGACCAAGGGGCCTCTCTTTCCAATGATGGCCAACT
AAGCCATCTTCTGCTACATATGCAGCTAGAGACACAAGCTCTGGGGGTACTGGTTAGTTCATTTTGTTGTTCCACCTATA
GGGTTGCAGACCCCCTTCAGCTCCTTGGGTACTTTCTCTGGCTCCTCCATTGGGGCCCCTATGTTCCATCCTATAGATGA
CTGTGAGCAGCATCCACTTCTGTATTTGCTAGGCACTGGCATAGCCTCACTGAAGCTATATCAGGGTCCTTTCCGCAAAA
TCTTTCTGGCATATGCAATAGTGTCTGGGTTTGGTAACTGATTATGGGATGGATCACTGGGTGGGGTANTCTCTGGATAN
TNNATCCTTTNGTCTTANCTCCCAACTTTGTCTCTAANTCCTTNCNNGGGTGTNNNGN
Sequence Type genomic DNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466892..114467343 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es