Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5885-NL
Clone ID PST5885-NL
Vector U3NeoSV1
Project escells

Sequence tag PST5885-NL
Sequence
CATGCACCCCAGGGGAGACTCCTGATTCCCAGCTAGGGACAGCCGTGGCCATAATAGACCTTAGAGAGATTGGCCTGAAT
TGCCCATTATGGGCACTGGGTGGCTGTGAT
Sequence Type genomic DNA
Unitrap ID UNI15151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56847392..56847501 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es