Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10245F12
Clone ID IST10245F12
Vector VICTR76
Project tigm

Sequence tag IST10245F12BBF1
Sequence
GACACACATTAAATGTACTCACATTAAAAAATATAAAAATAAATCTTTAAAATAAAACTTTCAGCATGATAGTGCACACC
TTTAATCCCAGCTCTCTGGAGGCAGAGGCAGGTGGATCTCTGTGAGTTCAAGGCCAGCCTAGTCTACAGAGTAAGTTATT
CCAGGACAGCCACANANAAACCCTGTCATGAAAGACAAACACACACACACATTANCACTTGCCCATANNCTCCTGAAAGT
ANTTTTCTGGTGCTANNNAGATCCATGTCTGTCATTATAAACTGCTGATCTTTTCTTCCTTGTGTCTTTTGCCAGTTCCT
TCCCCAGCTNCTGTTTAACTTTTTGCTTCCTGTGCTGTCTATCTCTACTACCNNTACCAAGTCTGCTGGAAATGAAACTC
AGGGGTTGCCATGCTNANNAGTTAGTCCTTTTTTTCTTTGTNTNNNGAAACCCNGNNNTACTATGNANNNNNNGCTGCTT
ANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10245F12HMF2
Sequence
GTTTATTTATTTATTTATCCATTTATTTTTGCAATACCACATGGTTTTTCTTTTGACTATGAGTTTCCTTTTGTTATTTG
GTCTTTTCTACTTAACCCTGCAATTAAAAAAAAAAGTAATAGATCAAATAGGAAGTTCTAGTGAACAANAAACCNNCANN
TNTTTGTTA
Sequence Type genomic DNA
Unitrap ID UNI34965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62659140..62659307 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es