Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14803H11
Clone ID IST14803H11
Vector VICTR76
Project tigm

Sequence tag IST14803H11BBF1
Sequence
CTAGTATTGCTTTATCTGCTGAATGGAAGAAATGTTTCACTTGGGCCAGGCAGACACTTACAAAGTGAAGACAATCACTC
TACAACTGAGCTACATTCCCCGCCTCCCACACCCACAAAAGAAAAAAAAAAGGTCANAAAAAAAACTGGAAANTANNTGT
GCTTGTNNCTNTTCCAGGGGGCCNGANTTCATTTCCNNNTGCCCACATAGGGNGNCTCAGGATTANCTGTNNCTCCNNCT
CCAGGAAATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14803H11HMF1
Sequence
CTAGTATTGCTTTATCTGCTGAATGGAAGAAATGTTTCACTTGGGCCAGGCAGACACTTACAAAGTGAAGACAATCACTC
TACAACTGAGCTACATTCCCCGCCTCCCACACCCACAAAAGAAAAAAAAAAGGTNAN
Sequence Type genomic DNA
Unitrap ID UNI31842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20363558..20363691 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST14803H11HMR1
Sequence
CTANTTATGAGAAATGGAGGCATACTAATTTTCAAAATTTAATTTCAGTATANCTAATAAACTGCTCCCTTTTTTCTAAA
CAAATCATACTATCCTCAACAATTTTGTTTTTATATGTTTTTCTGAATTTTTTTTTNCCTTTCAAAACCNNANATTACNG
GGCNTATNNAACCNGGTCCNNCTTTCAACCNNNGTNNNANANNGTNTTTATCACATTTTNNNNCCNGGTCAATTTANANT
ACCGTCNCTAANTCTTGANCAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es