Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14604B11
Clone ID IST14604B11
Vector VICTR74
Project tigm

Sequence tag IST14604B11HMR1
Sequence
CANAAAAGAGAGAAATTNTNNNTCCNTGCATACTATTTAGTGCATTCCCATGCACACTATTTAANTCTNACCTTTATTTT
NAAAATCTAATATTTTAATGTCAAAGAGTTTAATAAATGCTTTATAGTATCTTAAAGGGATCTACTTATTGGCTTATAGA
TTGATCCTAAAACAGCTACCTTATTAGAAAAGGGAAAAACAGGTTTTCTCCACNAAACNCTTCAAAAACNTATTAATTCG
TGTGACNAGCTGGTAGGTAANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14604B11HMF3
Sequence
TTGTCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI30509 UNI30626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 81750641..81750706 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079262 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789332 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24048349..24048414 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 108034981..108035046 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356564..91356629 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 77223461..77223526 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919927..52919992 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10809563..10809628 66
NO GENE  


Sequence tag IST14604B11BBF2
Sequence
TCTTTTAAGANGNNNAAGNNNNAAAATNTNACAATACCTAAACCTTTGAATTAATAACTAGTTGACAAAACATTTTAAAT
ACTTGGCTGTAAAGGGGCAGTGACTAATTGCACTTTTAATCAATTTTCTTAAGGAGCAGTTGTAACTAGAAGGCTTGCAA
AGTTATTAAGAGTCACATGTGCATAATTTATTTATTAACTAGAAATATGCATAAGCAATTGTAAATTTGAGAATTAATAG
TATCTGAGGGATGAACAATTTAAGCAATTGCGAGCTCAGAGATATGGCATTGACTATTAATATACAAATTAAGGTTTGAT
TGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATNATCTGTGCTGGAACAGGGGAAACTGTGTCTTAAGACT
CCGCCCCACANAAGCTAGTTGGGCCCACNTGNNNNNACGATCNGCTGGGANGATGANANNNATGACTTTNCAANAATGTN
ATCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es