Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5711-NR
Clone ID PST5711-NR
Vector U3NeoSV1
Project escells

Sequence tag PST5711-NR
Sequence
GTTTCAGACCAGCTTGGGGCTACATGAAACCTGTTAAGGAAAAACAAACAAACAAAAACAATTAGAAAAAGGAATTAAAA
AAAATTTTTTTTAACTAAAAAGTAAAATCTGTCAAGACCTATAGATATATAAGTAGACCTTGGCCAGGAGGTATGTAGCT
CATACCTATCATTCTTGAGCTTGGTTTTGTCCTGATCTTTTCATAGCTGATCTGGGATTGGATAGGAATTGGATAGGATT
GGGCCACCAGGTCACCTTTAAGCTTTTGAAGTCAACATG
Sequence Type genomic DNA
Unitrap ID UNI4248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127778053..127778331 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005683 (Cs) NM_026444 citrate synthase Gene [Source:MGI Symbol;Acc:MGI:88529]

 
Come back to gene ENSMUSG00000005683


For any suggestions or comments, please send an email to unitrap@crg.es