Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12340B6
Clone ID IST12340B6
Vector VICTR76
Project tigm

Sequence tag IST12340B6BBF1
Sequence
TATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI20271 UNI30958

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132240825..132240879 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028886 (Eya3) NM_210071 eyes absent 3 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Eya3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44562475..44562529 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032096 (Arcn1) NM_145985 archain 1 Gene [Source:MGI (curated);Acc:Arcn1-001]


Sequence tag IST12340B6HMF2
Sequence
TATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCGTCAGATCTCATTATAGATGGTTGTGAGCCACCAT
GTGGTTGCTGGGATTTGAACTCAGGACCTTTGGAAGAGCAGTCGGTGCTCTCAGTCATCTCTCCAGCCCCCCTTTTCCAT
GTTTTAAGGATCAGTTGTAGTCCCTTTGTTTTTCATCAACCTGCCTGCCTCTTGTATGCCTAGTAGAGTCTGGGGCCTCA
GTGGTTTACTTACTAGCAATGGAAAGGACAAAAAAGCTTTAGTTTAAATGTTCCCAAAGGAGCAAAGAGAACATTCCACT
ACCACCAAAAATAGAAGCCAGAGTTTCAGAGAGCCTTTCTACAGCACACTATCAGCTCTTACCAGCNNGTGACTCCTAAA
AAGTGGCCTTAAGTAGATTCCAAAATGTCCCTAANTGATGTGAAATGTCTCTACCAAAGTAGGAAAAGAGTTTAAAGCCN
GGACACNNTCTACAANAAGTGTGGGGGGCNAANCAGTCTGTGGGCNCAGCNGCNGTGACNGGGTTTTGTNNTGTTTTTGC
TTTNGANTCTTNNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95026025..95026593 529
 
EST/CDNA Est Name
  CB057719.1 - BI735887.1 - CX242872.1 - CB248507.1 - CX239686.1 - BU921887.1 - DV065977.1 - BU504002.1 - BB644564.1 - DV060363.1 - BG298544.1 - BU923878.1 - BU924194.1 - CD772579.1 - BU503570.1 - CD364089.1 - BU919398.1 - BU503986.1 - BQ892102.1 - CO427263

 
Come back to gene CB057719.1 - BI735887.1 - CX242872.1 - CB248507.1 - CX239686.1 - BU921887.1 - DV065977.1 - BU504002.1 - BB644564.1 - DV060363.1 - BG298544.1 - BU923878.1 - BU924194.1 - CD772579.1 - BU503570.1 - CD364089.1 - BU919398.1 - BU503986.1 - BQ892102.1 - CO427263


For any suggestions or comments, please send an email to unitrap@crg.es