Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14943D4
Clone ID IST14943D4
Vector VICTR76
Project tigm

Sequence tag IST14943D4HMF1
Sequence
GTACTCACATATATAAAATAAATAAATCTTATTTTTAAAAAAATGCAGGGGGCTGGANAGATGGCTCAGCCGTTAAGAGC
GCTAACTGTTCTTCCAGGGGTCCTGAGTTCAATTCCCANCAACCACATGGTTCTCACAACCACCTGTAATGGAATCTGAT
GCCCTCTTCTAGTGTGTTTGAAGACAGCTATAGTGTACTCACATATATNNNNNNNNNAAANNAATCTTTTTTTNNANNAA
ATCNNTTAANAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14943D4HMR1
Sequence
AGTACATTGCAGCAGTCAGACATTCTAGAAGAGGGCAGTTCTAAAGGGAAAAAAATAGAACTTCATTCCTTACAATAGGC
TTTACAGTGAGCAAATGGGGGGGGGAANACAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI19584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77412321..77412442 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017291 (Taok1) NM_144825 TAO kinase 1 Gene [Source:MGI (curated);Acc:Taok1-001]

 
Come back to gene ENSMUSG00000017291


For any suggestions or comments, please send an email to unitrap@crg.es