Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4848-NR
Clone ID PST4848-NR
Vector U3NeoSV1
Project escells

Sequence tag PST4848-NR
Sequence
CCTTGAGATTAAAGTAGTACAGATTCTTCACTGATCGTGGGAGTTTAGTTTCTATGCAAAGCATTCGCCCTTCTCAAGAG
CTGCTCACACACTAGTTTAACGTGACCTCTAAGAACCAGCAAGCCATTGTTGTCCCAAGGTCACCGAGCGCTGTACTGTT
GTGGCAGCCTGAAGAATTTCAGCCCTTCTCCATAAGAAAAGGCACTTGAGACGTAGAGGAATGGAGACAGTTCTTTAACC
CAACCCCAGCTTACGGCCCGTCTAACCCAAGATAGAGTACTAATGCTCTGTCCCTTACATAAACTAAATGTTCTGTTCAG
TAGGACTGACAGCTAGTTTTTGTGGGTTAAGGTCATTGGTTGCACAACACTTAAGACCTTACTGCCCTCCGAACCTTGGT
AATGAGATAAAAACTTAACACCTACTGCATATAAATNCAAATTTGTTTTATCTTACCTGTTGAGGTATGGAAGGTAGCCT
TTGTTTTGAATTATTCAACAAGCAACTACTATTGTTAGTGACGAAAACCTCAACTNNTAGAAGTGGTGTGGAAT
Sequence Type genomic DNA
Unitrap ID UNI15422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 145160071..145160630 512
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040370 (Lyrm5) NM_133688 LYR motif containing 5 Gene [Source:MGI (curated);Acc:Lyrm5-002]

 
Come back to gene ENSMUSG00000040370


For any suggestions or comments, please send an email to unitrap@crg.es