Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4840-NL
Clone ID PST4840-NL
Vector U3NeoSV1
Project escells

Sequence tag PST4840-NL
Sequence
CATGTTCATTCCTGATGGACGTGTGTCAGTCTCTGCTCGAATTGACAGAAAAGGATTCTGTGAAGGTAAAAACATACTGC
TTCAAATGTCTAGACAGGATAGCCAGAACTGGGGGTGGGGGGGTTGGGGGTGGTACGGAGAGGGTCGTAGGGT
Sequence Type genomic DNA
Unitrap ID UNI15677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96363294..96363445 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038393 (Txnip) NM_023719 thioredoxin interacting protein Gene [Source:MGI (curated);Acc:Txnip-001]

 
Come back to gene ENSMUSG00000038393


For any suggestions or comments, please send an email to unitrap@crg.es