Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14667E4
Clone ID IST14667E4
Vector VICTR74
Project tigm

Sequence tag IST14667E4BBF1
Sequence
TCTTTTAAGAGGCCATGCTCTTTATATGAGCACATAAATGTACGCGTTCATGCTCACGAGTGTAAAGAAGTCAATTTGTC
AGGAGCTGCATGACTGACTAGGAGAAATAAATAATTTTTAGTCTTTGGGCTTTTCTGTATCTTGCTATTTGGGAAATGGA
GTTGGGCTGCAAGGCAAATGAATTTCGCCTGTCATGTACACAAGACAGTTTGTCAATACAGGAAANNANTCNNNNNNNNN
NNNNNNNNNTGCTTCNTATAAAAATATTTTCAATTATTATAAACGGCTAAAGGTNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30738185..30738478 225
NO GENE  


Sequence tag IST14667E4HMR1
Sequence
NANCAGTAACGGGCTGGAGAAATGGCTCAGTGGTTAAGAGCACCGGCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAG
CAACCACATGGTGGCTCATAACCATCTCTAATAGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGATGGCTACAGTGTAC
TCACATAAAATAAACAAATCTAAAAAAAAGAAAAAAAAAGAGCATTANCATCNTATATACNGTTCTGTAACTTACGGCTC
TTATTTAACCNTTGATGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30737925..30738183 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]


Sequence tag IST14667E4HMF1
Sequence
CTCTTTTAAGAGGCCATGCTCTTTATATGAGCACATAAATGTACGCGTTCATGCTCACGAGTGTAAAGAAGTCAATTTGT
CAGGAGCTGCATGACTGACTAGGAGAAATAAATAATTTTTAGTCTTTGGGCTTTTCTGTATCTTGCTATTTGGGAAATGG
AGTTGGGCTGCAAGGCAAATGAATTTCGCCTGTCATGTACACAAGACAGTTTGTCAATACAGGAAAATAGTCNAGTCCTG
GAGATACTGATGCTTCATATAAAAATATTTTCAATTATNATAAACGGCTAANGGTAGCACTCGTTCAAACGCGGTCTTNA
CACATCTCCACACAATCCTACCCGCCTAACTTCCACCCACAGAGTTTTTCANNNATGCNTTCNTTCATTATCTNANCCAT
CANATGTGCACNCACGTTCGTAAAGGCACATAAAGGANNACGAGCANATTNNNNTCNNATNNCGGCTGNTGCAAANCNCA
GGCNTCCCGTCCTCTACCCNCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es