Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4665-NR
Clone ID PST4665-NR
Vector U3NeoSV1
Project escells

Sequence tag PST4665-NR
Sequence
TAGTGACCCCCAAAATAAGTTTTTAAAAAAATTAACCATGTAAGCGTCAACCATGGAACCTATATATATATTATGGATGA
TGAACGCGCACAGAATTCCAATACCATCCTGAATACCCCAAAGGAATTAACCCATGAATTTAACCAAATTGGGATACCCA
AGCCTTAAGAAAAATTTTTGGGAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCCTCTCTCAGGGGTGTGTT
TCTCTCCTTTGTATTTATTCCCCCCCCTGGGCGCGTGTGTCTCTGTGGGAGAAACCCC
Sequence Type genomic DNA
Unitrap ID UNI13708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71733845..72054468 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es