Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4333-NR
Clone ID PST4333-NR
Vector U3NeoSV1
Project escells

Sequence tag PST4333-NR
Sequence
GCGGAAAGGAGGGGACCCTCCCAGTGGGTGAGGGGCAAGGCCTCCATCATCTCTGTCTCTTCCTGTCTAAGGGGTCTCCA
ATGACACGTCTTCACTGGAGACAGAACGCGGGTTTGAGGAGCTGCCCCTCTGCAGCTGCCGCATGGAGGCTCCCAAGATT
GACCGCATCAGCGAGAGAGCAGGGCACAAGTGCATGGCCACAGAGAGTGTGGATGGAGAGGTGGGTCTGGGTACGGTTGG
CTTAGGGGGCCCAGGGTGAGCTAGCCTGGGCCCTGGCCTCACCCTACATG
Sequence Type genomic DNA
Unitrap ID UNI15688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35042784..35043072 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013787 (Ehmt2) NM_145830 euchromatic histone lysine N-methyltransferase 2 Gene [Source:MGI (curated);Acc:Ehmt2-003]

 
Come back to gene ENSMUSG00000013787


For any suggestions or comments, please send an email to unitrap@crg.es