Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4312-NR
Clone ID PST4312-NR
Vector U3NeoSV1
Project escells

Sequence tag PST4312-NR
Sequence
GGTGGAGGTTTGTAATTGGCTCTGCCACCTGTTTCTGTGTATTGTGTGTTAGGATAACATTTTAGGACTCAGAAGGGGTG
CTTTTGAAGTATAGTCTGATAGAAACTACTCCAGAGCCTGAGGGTATCTGACCACGCACTTCTCTTCCCCAGCACACTGG
TATTCAGCCCGTTTTGAGGTTTAAGTAATTCCCCTTTCAGAATTCCATATGGAGTTCAGTAAGAGGAACTTACAGAACTA
TGACCAACCCTCCAACCCCTCTGAAGTCGCATG
Sequence Type genomic DNA
Unitrap ID UNI11950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14164019..14164291 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022678 (Nde1) NP_001107557 nuclear distribution gene E homolog 1 (A nidulans) Gene [Source:MGI (curated);Acc:Nde1-006]

 
Come back to gene ENSMUSG00000022678


For any suggestions or comments, please send an email to unitrap@crg.es