Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4274-NL
Clone ID PST4274-NL
Vector U3NeoSV1
Project escells

Sequence tag PST4274-NL
Sequence
AGTAGTGCCACTTCCTCTAGGCCAAGTGTTCAAACACAGGAGTCTGTGGAGGCCATTCCTATTCAACCCCCACACTGGCT
TATGAGCTCAAGATATAGCCAGGTGATATAGATGGAGACAGAATCTCACTGTGTAATCCAGGCTGGCCTGGAACTCATGG
AGATCCACTTGTCTCAGCCTCCCAAATGCTGGAATTAAAGGAATGTGTTACTGTGACCATCTTCTCTAAGGCAGTGTCAC
CAAATAAAATATTTAGTGAGTTTAAAG
Sequence Type genomic DNA
Unitrap ID UNI15689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27986200..27986466 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024217 (Snrpc) NM_011432 U1 small nuclear ribonucleoprotein C Gene [Source:MGI (curated);Acc:Snrpc-001]

 
Come back to gene ENSMUSG00000024217


For any suggestions or comments, please send an email to unitrap@crg.es