Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10878C9
Clone ID IST10878C9
Vector VICTR76
Project tigm

Sequence tag IST10878C9HMR1
Sequence
CCGTTGTCCNGCCTCATACTCNATATTTAAGGGCTTCTGTCCCCTGAGCCTCTCGTGAACTTTTTCCCCACTTTGTAGAT
TCGGTCATATTTCTTGTCAAAACAAGAGTGGAACTTGACCCCAAGTCTTTTTCTAAGCACATTCTTTATTCCATGCTGTT
ACTAGTATACACAGCTCCTGGGCCTCCTAAGTGCTGGGATTACAGGCATGTGCCACGAAGCCTGACTCGTTCCTGANATC
NTGGAACCGCCACATCTCTGCNGTGGCTCCCCTCANAGTTTCATTGGCCTCACCANACTTATGTNNNANACTCNCTTCTT
CTGTGTGTGTGTGNTTA
Sequence Type genomic DNA
Unitrap ID UNI5528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35385544..35385879 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es