Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14683B4
Clone ID IST14683B4
Vector VICTR74
Project tigm

Sequence tag IST14683B4HMR1
Sequence
CTGCTGANCATGGATGGTTTTGATAAAGTAATAAGGAATCCCATTTGTACAACTAGCTCTTTGAGCTGCAGGGAGAGAAG
GTCACTCTTGGGCATCTTATTCTGTACTCCCTAAAAAAGAACCGGATGCCCAGGAAAAGCATCTTCTAAGACCACTTTAC
AGCTTCTTTTATTCCCTGACTTCTCTAGGAAAGGCTACTTACAACTTCTGTACACAGGTAGGGTCCCCTCTAAATCTCCT
TCATTTTCCCATGGGGACCCATTGGTTATGCCTTGGTGGACTTCATGTTAATGTCNCCACTGGCTTTCCTTCATTGTTAC
AGGGAATGGNTTTTN
Sequence Type genomic DNA
Unitrap ID UNI10643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77789343..77789676 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]


Sequence tag IST14683B4HMF1
Sequence
AGCAGAAATTCNCAAAGTCCAACACAGTATAGACAGACAGACAGACAGACACACACACACACACACTGAAAGANAANACT
GACTACCTGGCNNGTGACANAAATGAAATGGTCCANAATANCTTACCTGATCTGGAAAAGCTATCACATATTTCCNTGTG
CACAAAAAGCANAANANCTGANCCTGTTAAAGCACANCANCNNCCGTCTAANANAGCTTGCCANTTTCCTCCCGAGGCTT
CTGTCATACACACNANCCGTCTAAAGCATTCCCTCNATCTGGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14683B4BBF1
Sequence
AGCAGAAATTCACAAAGTCCAACACAGTATAGACAGACAGACAGACAGACACACACACACACACACTGAAAGACAAGACT
GACTACCTGGCNNGTGACAGAAATGAAATGGTCCAAAATANCTTACCTGATCTGGAAAAGCTATCACATATTTCCNTGTG
CACAAAAAGCAAAAGAGCTGAACCTGTTAAAGCACANCNNCNNCCGTCTAANAAAGCTTGCCNCTTCCTCCCGAGGCTTC
TGTCATACACACNANCCGTCTAAAGCATTCCCTCCATCTGGANATCANCTGCNNCCANCCTGGGCTGCCGTTAACAAACA
CTCAANACAAAATGGCTCANGAAACTATTTCTTCCGCATAGTGATGGANGACAGANTGTCCANAGCTTTTTGTATTTCTT
TCTTGNTGTTTTGGTTTGTTGANACANANTCTCACTCTGTNCCTCTGACTGGCCTGGAACTCACTATGCANANNNNGCTG
GCCTTGAACTCANNNATCTGTCNNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032349


For any suggestions or comments, please send an email to unitrap@crg.es