Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3998-NL
Clone ID PST3998-NL
Vector U3NeoSV1
Project escells

Sequence tag PST3998-NL
Sequence
TTTGTTTTGTTTTAATGTAGTTTTGTTTGTGGCAGTGTGTCGCATCACCCAGGCTGGCCTCAAAGCTCAATATGTAACCG
AAAATGACCTTGAACTTCTGAGCCTCCGGCCTCCACCTCCCGAGTGTGGGGTGTAGGCCTGTGACACCAGTGGTGCTGGG
GGTGGGACCCTGGGCTTCCTGGAAGTTAGGCAAGCGCCCCACTGGCTGAGCTACATCTCCAGCCCTATATAGGTGTGGAC
AGTAAGTATCCAACCCAACTCT
Sequence Type genomic DNA
Unitrap ID UNI15694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4654831..4655092 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035390 (Brsk1) NM_001003920 BR serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Brsk1-002]

 
Come back to gene ENSMUSG00000035390


For any suggestions or comments, please send an email to unitrap@crg.es