Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14161H7
Clone ID IST14161H7
Vector VICTR74
Project tigm

Sequence tag IST14161H7HMR1
Sequence
TTTACTTTTCTGCTTTGTGTAGCAGGGCAATCACTGGGAATCGGCCACGTATAATCCGGCGGTTTGTCATATTTTATTAG
TGAAAGTATTTTATGCCTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92022929..92023027 99
NO GENE  


Sequence tag IST14161H7HMF1
Sequence
GTAAATGCCATCATCCCCCTTAGAACAAAAGAACTTAGGAATAAAAAACATGGAGAGGGGGGCAGAAAGCAGCAATAAAT
AAAGGTGAGCGAAGGACCCCGTCCCCCGCCCCTCCCCGGAGCTAGAGTGGGACTCGGCACGGCTAATAAAGTC
Sequence Type genomic DNA
Unitrap ID UNI31455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92023023..92023174 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es