Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3675-NL
Clone ID PST3675-NL
Vector U3NeoSV1
Project escells

Sequence tag PST3675-NL
Sequence
ATGCACAGATGTGCGTGCTGAGTCAAGTGCAGCCTGCCTCCAGCTACCTGTACCCCAATGTGCCCGTCTTTGGGCCAGGG
ATACGGGGTCACCTGTCACTTCCCTCCCCAGCATCCGAGAACCCCTGCTCAGCAGCTCTGAGAATGGCACTGGAGGCGCA
GAGATGGCTCCAGCTGATGGTAAGTCTCAAGGTCACTGGCTAGGGGAGGTCACCTGAAGCCAGACAGGACCTGAGCATCC
CT
Sequence Type genomic DNA
Unitrap ID UNI15697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25710160..25710401 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es