Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12926A8
Clone ID IST12926A8
Vector VICTR76
Project tigm

Sequence tag IST12926A8HMF1
Sequence
ATAGACCAGGCTGGCCTTGAACTCANAAATACGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGC
Sequence Type genomic DNA
Unitrap ID UNI16649

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48287716..48287787 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058550 (Dppa4) NM_001018002 developmental pluripotency associated 4 Gene [Source:MGI Symbol;Acc:MGI:2157525]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115586214..115586285 68
NO GENE  


Sequence tag IST12926A8BBF1
Sequence
ATAGACNAGGCTGGCCTTGAACTCANAAATACGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000058550


For any suggestions or comments, please send an email to unitrap@crg.es