Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3637-NR
Clone ID PST3637-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3637-NR
Sequence
GTCCTCACCTTTCCATTTTTTAAAATGTTTTATTATTTTTTAAAGTTAATTTTTTTTAGTTTAAGTTTAGTGTGTGTTAG
TCTCTGAAAGTGTATGCCA
Sequence Type genomic DNA
Unitrap ID UNI14861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91397279..91397377 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es