Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST338
Clone ID PST338
Vector U3NeoSV1
Project escells

Sequence tag PST338
Sequence
TTTNTTAAAAAGCTTGCCGGCNAATGGCTGCCGGTTCCTTGGGGTTTACGGTATNCCGGTCCCGATTTGCAGGGCATTGC
CTTTCTAATNGCNTTCTTGCGAGTCTTCTGAACGGNACTCTGGGGTTCGAAATGAGNTAGCCCTTAATCACTTAGGTTTT
GTGGTTATAGATTTTGTTGTAGGCACCCATGTATGACATGTACTCATTTTTCTTTGACAAACACCAGGGGGTGGAATTGA
TGGGTCATGTAATTCTCTAAAGTGTGTTGATTCTGTGTTTGACTTTTGGCAGTACCACTGCCACACCATTTCGCTTCCCT
AAGAGTAAAGTATGCAGATTCAAGTCTCTCCACCTTCTGTGTTGCTGTGCATGGTTTTGACCATAGCCTTTCGANTGAAT
GCTAAGTTG
Sequence Type genomic DNA
Unitrap ID UNI15699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 123082296..123082558 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028114 (G430022H21Rik) NM_201638 RIKEN cDNA G430022H21 gene Gene [Source:MGI Symbol;Acc:MGI:2442926]

 
Come back to gene ENSMUSG00000028114


For any suggestions or comments, please send an email to unitrap@crg.es