Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3302-NL
Clone ID PST3302-NL
Vector U3NeoSV1
Project escells

Sequence tag PST3302-NL
Sequence
AAGACAGAAAGGTTGCCTGTTGGCTAGCCTGGTCTACAGAGTGAGACCTTTTCTTAGCTGGGGTCATTTTTTGAGGCTCA
GGTTTGGTACAAATGAACCTGGATATTTTTTGTTTCCTGTCACTCAGGTCCAGTGCTCGTGCCAACATCACGCTGTCTGG
GAAGAAGCGCAGGAAACTCTTGCAGCAGATCCGACTTGCCCAGATAATGAATAAAGCAGCCATGGAAGAGTAAGTACTAT
GGGCACAGAGGATACACAACAAGAAGTACTGAATTTTACCT
Sequence Type genomic DNA
Unitrap ID UNI15356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8964368..8964639 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071653 (1810009A15Rik) NM_025463 RIKEN cDNA 1810009A15 gene Gene [Source:MGI Symbol;Acc:MGI:1913526]

 
Come back to gene ENSMUSG00000071653


For any suggestions or comments, please send an email to unitrap@crg.es