Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10258A2
Clone ID IST10258A2
Vector VICTR76
Project tigm

Sequence tag IST10258A2HMF1
Sequence
TTTATTATATGTAAGTACNCTGTAGCTGTCTTCACACACTCCANAAAAGGGAATCAGATCTTGTTACACATGGTTGTGAG
CCACCNTGTGGTTGCTGGGATTTGAACTTCATACCTTCGGAGAGCAGTCNNGTGCTCTTACCCACTGANCCNTCTCACCN
NCCCGTATGCATGCATTATTATGCATGAAACTNCNCTGCANCTGTCTTCTGACACACACCAAAAGAATACNTGGGATCCC
ACGGCANATGGTTGTTGGAAATTGAACTCANGACCTCTGGAAGAGAGGTCAGTGCTGAGCCATCTCTCAAAATAAAACTT
GTGGAGAAATTGANCATCTTANNNCCCTAGGCATCCTTCCTCCCTCTCTCCACGTGGAACGCCATCAAAAATAATTCGCG
TCTGGCCTTCCTGTACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 363586..423417 129
NO GENE  


Sequence tag IST10258A2BBF1
Sequence
TTTATTATATGTAAGTACACTGTAGCTGTCTTCANACACTCCAGAAGAGGGAATCAGATCTGTCGAGGTCGATCGACGGT
ATCGATTAGTCCAANN
Sequence Type genomic DNA
Unitrap ID UNI14679 UNI31022 UNI31167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11766404..11766464 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35354731..35354791 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021798 (Ldb3) NM_001039076 LIM domain binding 3 Gene [Source:MGI Symbol;Acc:MGI:1344412]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 51738154..51738214 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10692514..10692574 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 37205754..37205814 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079714 (Pcdha6) NP_031793 protocadherin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:1298367]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5733085..5733145 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3302184..3302244 59
NO GENE  

 
Come back to gene ENSMUSG00000079714


For any suggestions or comments, please send an email to unitrap@crg.es