Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12241G3
Clone ID IST12241G3
Vector VICTR76
Project tigm

Sequence tag IST12241G3HMF2
Sequence
AAAACATCCAAACACAATTTTTAAAAAGAAATATATATATATATCTGGTTTTTCGAGACAGGGTTTCTCTGAGTAGCCCT
GGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCAAACTCAAAAATCTGCCTACCTCTGCCTCCTAAGTGCTGGG
ATTAAAGGCGTGCACCACCACGCCCGGCTCAAAATATTTTTTACAAAGTATGTGTAAGAGAGCCTGCATACATACATGCC
ATGCGTCTTCCTGGTGCAGGGCTAAGACAGAANAGGACATCTGATCCCCAGGAGCTGCAGTGGTAAACTGTTGCAAGCCA
CCACTGGGTGCTGGGAAGCAAGCCAGGTCCTCCAAAAGCGCANCCNATGTTCTTAACCTCAGANCCNTCTCACTAGACCC
AAGCCCAAACCTGAGTGCATAGCTGTTTCTGAAGTTNAAATGTCTTGCCCAGCANCAGTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70095956..70096416 445
NO GENE  


Sequence tag IST12241G3BBF1
Sequence
GGAGGACCCTACGACAGGAAGGGAAGGGTGGAATAATGAGCCTTATGGAAACAGAATGAGTAGGATGGAGTAGGCTGAAA
TGGCAGATACCACTTCTGAGCAATGACGGTGCCTTTGGAGAAGGGCAAGGAATAGGCAGAGGTCTCTGTGAGCAGGGCTG
GTGGCAGAGGGGACTCACTCAGTGACAGATGCAAGAGTGGGCACAGAGGTGAAGAACACATTGGAGAACTAAATTCCAGT
TTGGGCAGCCTGAGAAGATCCAGTGGAGCAGAGAGAGATGGCTCAATGGGCAGAGGTGCTTGCTCCCAAGCTTCCACCAT
GTGGGTCCCAGGGATCGACCANANTTNNNTCCCN
Sequence Type genomic DNA
Unitrap ID UNI32499

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40142738..40143090 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es