Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13572B8
Clone ID IST13572B8
Vector VICTR74
Project tigm

Sequence tag IST13572B8HMR1
Sequence
AGCCTGGTCTGCAAAGTGAGTTCCAGGACAGTCAGGGCTATACAGAGAAACCCTGTCTTGAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI1946 UNI31659 UNI31660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 18731222..18731287 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 75358637..75358702 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62664394..62664459 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 113483696..113483761 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 110092182..110092247 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044749 (Abca6) NM_147218 ATP-binding cassette, sub-family A (ABC1), member 6 Gene [Source:MGI (curated);Acc:Abca6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4372552..4372617 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 71100298..71100363 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 126345388..126345453 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 153277502..153277567 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052544 (St6galnac3) NM_011372 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1341828]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22952235..22952300 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 78560361..78560426 64
NO GENE  

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es