Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3128-NR
Clone ID PST3128-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3128-NR
Sequence
AGATTGAAGGTAAGAACTGGGGAAGTGTGGTCTGTGGTCCCATATCCTGTGTGGCCCTGGGGCTCTGATTCACATGGGGT
GCAGGGTTAGGCAGTTTGGGGTCGCTGACCTGGGAAGGTGCACATTTCTGTGTCCACAGGTGTAAATATAGTGCATATAG
GAGTATGGGTGGGGTGCTCAGGGCATG
Sequence Type genomic DNA
Unitrap ID UNI15705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29114859..29115045 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003435 (Supt5h) NM_013676 suppressor of Ty 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1202400]

 
Come back to gene ENSMUSG00000003435


For any suggestions or comments, please send an email to unitrap@crg.es