Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3054-NR
Clone ID PST3054-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3054-NR
Sequence
ATGCCCAGTCAGGAAAGTGGCCAGTGGCCACTCACCCGAAATCTCACAATGCTGGTTGGTATTCTCTTCCATTCCTCTCT
GCATCCTACTGGAGCAACTCTAATTGACCTTCAGCATCTGGA
Sequence Type genomic DNA
Unitrap ID UNI15708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90288808..90288929 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es