Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14864G6
Clone ID IST14864G6
Vector VICTR76
Project tigm

Sequence tag IST14864G6HMR1
Sequence
NNNTGTGGTTGCTGGGATTTGAACTCCGGACCTTCGGAAGAGCAGTTGGGTGCTCTTACCTGCTGAGCCNTCTCACCANC
CCCTTGTCCCTGTTTCTAATGATGATGAACGGTGGCACCCTTTANCCTGTTCCCTGAGGCCCCTTCTTGGTCCAACTCAT
AAAAACCATGTTTTTANCTCTGTANAAGTTAATTTTCCCTTCTTCCCTCCNGGCCTATGGTTTTGCTTTGTANATAGCTC
CTTTGTGACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129469204..129469450 233
NO GENE  


Sequence tag IST14864G6BBF1
Sequence
ATGGTGGCTTACAACCATCCGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI8934 UNI25835 UNI35415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 181439859..181439891 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055067 (Smyd3) NM_027188 SET and MYND domain containing 3 Gene [Source:MGI (curated);Acc:Smyd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 70715702..70715734 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55280760..55280792 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72899857..72899889 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 56161525..56161557 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 61742663..61742695 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 37102714..37102746 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 21047441..21047473 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32813005..32813037 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91210205..91210237 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 48615176..48615208 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028347 (Tmeff1) NM_021436 transmembrane protein with EGF-like and two follistatin-like domains 1 Gene [Source:MGI (curated);Acc:Tmeff1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 90660633..90660665 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13526674..13526706 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 14295824..14295856 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109760105..109760137 33
NO GENE  

 
Come back to gene ENSMUSG00000028347


For any suggestions or comments, please send an email to unitrap@crg.es