Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2576-NR
Clone ID PST2576-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2576-NR
Sequence
AGAGAAGGCTGAAGAGCACAAGAGATTATGCTCCCAGGGTGAGCCTCATAGATTGAGCGGGTCCAGATGCAGTATCTTTT
CAAGTCTGGTCCACACTGAGGACCAGCATCAGTCAGGCTGGTCTTGCAGTCTGTGGGCTGGAGGGAAAGAGCCTTTCTGC
ATCTGTCAGATGTGCTCAGAATCAAGAGGGAAGCTTTTACTTTCTCACTGATCTTTTTCACAGGGAGGGTTGGTTGCTAT
TATTTAAGGAGGGAGCTGTTAGTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99316060..99316326 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es