Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14942H6
Clone ID IST14942H6
Vector VICTR76
Project tigm

Sequence tag IST14942H6HMF2
Sequence
GTCCAGTAACACTTTCAGGAGCGTGTGCCTGACGAGTCTTCACACTGACTACGGTTTTCTCTTTGCAAAGGAAAAGGACT
CTTGCCAGTAGCTGGGACTTGGTTGAATGCTTCTCTAAGATGACTAACGATAGCTGGGACGCCCAGTGACAAGGCTTGTG
GCTTCCCAGGCCTCCAGCCCTCACCTTCGGAAATACAACTAACTGTCCAAGCGACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59776138..59776353 216
 
EST/CDNA Est Name
  NM_027307.4


Sequence tag IST14942H6HMR1
Sequence
NCCCTTCCCTGCTGANCCCCACAGTCTTGGGTGACTGGGGCCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34933505..34933547 41
NO GENE  


Sequence tag IST14942H6BBF1
Sequence
GGGCTTGCAGTGCGCGGATGGCGACTGGGGTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34933545..34933581 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es