Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12475C3
Clone ID IST12475C3
Vector VICTR76
Project tigm

Sequence tag IST12475C3BBF1
Sequence
ATAACAGACAGGTCTTAGTATGACAGGCCCATTGCTAAGGAACAAACTCTTCAGCCCCACTCTAGGTTGAAGGCGGGACC
GAGCCTCACAAAATTGAGGGTGGGGAGTAAATACTTCACTCGAAGGTGCCAGAGCTGGGTCCTGGGTACCGCTCAGCCAG
CCGGTTGTTGGGAGTAAAGTCCTTGAGCCATGTTGATAAGGGCCGAGTAGTCACTTATTATCTTCCTTTAGATTCAAAAA
TTGTGGGCCCCAACAGAGCTGGTGGTGAATGGAGAGAGGAAGGAGTTCCCTCCGCCTGTCCTTGGGAAGGACTACAATTT
TGTAAATGGGTCATGCATGCTCTATGAAGCCNACCACGTGCGTGAGTGCCTGCGTAAAGGTGAGGAGGGGCGGAGGGCTG
CACTGGGGCTACATCTGANGGGACTGTTGTGTTCTAGCCTGNCCTGAAACGCAAGTAGCTATTTAGAACTACATCTCCCA
NGATTCAGANAGATAGCCNCCTTCTNNAACTACCCTGNCCATGNCGCAAANACTTCTGGGAATTNAN
Sequence Type genomic DNA
Unitrap ID UNI30801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52730810..52731353 522
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]

 
Come back to gene ENSMUSG00000011382


For any suggestions or comments, please send an email to unitrap@crg.es